XIII Descenso del Nalón.

8 06 2008

Cartel del Descenso con una imagen de Sandra Hevia

El 31 de mayo tuvo lugar el XIII Descenso del Nalón, Príncipe de Asturias en el que participó Nuestra alumna Sandra Hevia.
Aunque éste año su participación fue de forma virtual (ver cartel) y como espectadora, amenaza muy seriamente con ganarla el próximo año en el río.
Entre tanto, vamos a navegar todos con ella de otra manera. Participaremos en una competición virtual, en tiempo real, a la que estáis todos invitados.

Pincha   participa desde LiveSkipper

Sandra, nos ganarás en el río, pero en mar abierto… ¡ No nos pillarás tan fácil!. 😉

A flote… siempre a flote.




119 responses

9 06 2008

El “mariaad board” acaba de zarpar rumbo a Boston, participando en la regata “The Artemis Transat”.
Tras un intento fallido que terminó en naufragio, sin consecuencias graves gracias a dios, corta el viento a 4.9 nudos, con su spinnaker, a punto de virar en el primer punto de control situado en Eddystone Lighthouse.
Si no embarranco esta noche, mañana… más.

9 06 2008

El “mmarem board” acaba de apuntarse a la misma regata “The Artemis Transat”. Va con su Spinnaker rumbo 177 a 4,2 KTS. No se avista el mariaad por ningún sitio. Ni idea a donde me dirijo. Esperamos ver un montón de barcos navegando junto al barco de Sandra, tenemos un mes para experimentar.
Donde será ese punto de control “Eddystone Lighthouse” vaya líos en los que nos mete Rosina, eres la caña de España.

A ver si coneguimos un montón de barcos.

9 06 2008

Nuevas propuestas de formación a distancia.
O incluyen urgentemente ” Patrón de barcos de recreo”, o educación va a perder a más de uno de sus efectivos para el curso próximo.
Que alguien avise a Nicanor.

Mar. Despliega en la ventana de navegación de la regata, el cuadro “buscar los amigos”. Pones el nombre del barco,y das a buscar. En la pantalla resultados que aparecerá, sale en naranja el nombre, lo pinchas y pasa a la ventana, mis amigos. Luego tienes la opción en la parte baja, de ver “solo mi barco” o no, Aisss

9 06 2008

MaDrE mia Q bIeN SalGoOoOoOo xD
BuEnO qUe MuXaS gRaCiAs X dEdIcArMe El BlOg, Y yA qUe SoIs LoS uNiCoS qUe PoDeIs EnTrAr En La HaBiTaCiOn HaBeR sI vEnIs A vErMe EhHhHh(y asi me devolveis el cartel jaja)
A x CiErTo Ni CrEaIs Q mE VaIs A GaNaR eN lO dEl BaRcO q UnA yA tIeNe ExPeRiEnCiA sObRe El AgUa Q sOy CaMpEoNa deL mUnDo En k-4 AuNq SiN mIs AMiGaS nU hUbIeSe SiDo PoSiBlE…..
y PaRa TeRmInAr QuIeRo Q sEpAiS tOdOs Q dEnTrO d 100 DiAs EmPiEzO a ReMaRrRrRrRrRrR r Q gAnAs TeNgO….
BuEnO pUeS eSo Q mUxAs GrAcIaS a MaR, RoSa e IsAac.
Un BeSo MuY gRaNdEeEeEeEeE……


9 06 2008

Ahora si que no vamos a tener compasión, necesitamos saber el nombre de tu barco para poner todos el rumbo hacia él.
Te devolveremos el cartel el próximo día. a ver si podemos ir de uno en uno y así te parece más tiempo.

9 06 2008

Sandra, que alegría tan grande nos das. Y que disgustos, por dios! ¿no habrá manera de que bloquées la tecla de las mayúsculas del teclado? ¿No ves que estamos muy mayores ya? NOS VAÍS A MATAR 😉
Y no presumas tanto de experiencia en el agua y demuéstranoslo poniéndote a navegar, que yo ya tuve un naufragio y Mar un embarranque. Mira en el buzón spam de tu correo hotmail y tendrás el correo de LiveSkipper para activar tu cuenta.
Que estos 100 días pasen rápido. A REMAR 🙂

9 06 2008

mamaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa. Esto es lo que me faltaba. Si en la vida erasmus se hace poco, tu vas y me das mas distracciones. Pero por otra parte, gracias. El buscaminas y el solitario spider empiezan a aburrirme. Preparaos, xk he estado movilizando a mis grumetes y pronto partira una embarcación desde tierras germanas, con la intencion de remar todos en la misma dirección. ¡¡¡COMIENZA LA REGATA!!!

9 06 2008

Holaaaaaaaaaaaaa, ya hay otro barco más en la regata, arual boat, así que prepararos todos que os va a ir adelantando poco a poco, y eso q tenéis q tener en cuenta que ha slaido más tarde que el resto eh.

Un beso!

9 06 2008

**no taras sola nunka, de acuerdo???Animo**

9 06 2008

Hola, es un placer estar rodeado de tantas velas y de barcos que casi entrechocan entre ellos, jejeje …
suerte a todos y todas
en especial a Sandra, claro ….

10 06 2008

aqui esta otro barco n l regataaa, mariuky boat
preparaos q a mi n me gana ni jack sparrow!!!!

animo sandra!!!!



10 06 2008

Biennnn! Observo que sandry viró el rumbo hacia mejores vientos, pero como no se ande con ojo… se “estrapallará contra Arual ( a la espera de ampliación y mejora de mi vocabulario náutico, tendréis que aceptar estrapallar)
Nos queda recuperar mariahevia, tristemente naufragada en la costa norte de Bretaña.
Comunicaros que se ha incorporado a la regata el “teo” capitaneado por un intrépido navegante, dispuesto a ponernos las cosas dífíciles.
Bienvenida también mariuky, (no te queda ná para pillarme jejjejeje)

10 06 2008

Cuidadooooooooooooooo Sandra, q vas a chocar con arual boat! (eso si consigo q mi barco se mueva, q llevo 4 horas parada por ir en dirección contraria al viento) ;(

10 06 2008

bueno bueno d momento voy un poco mal pero ya mejorare jajaja
voy a agregar los barcos nuevos haber a quien ganooooo

muxas gracias a todos los q me dan animos

si me quereis agregar dejo el msn: sandriusky69_91@hotmail.com

bueno q sepais q le puse bien el barco a mi hermana(mariahevia) y ya va mejor xD

estais todos invitados a ir a ver mi primera carrera d piragüismo jajajaja

venga xaooooo bssss


10 06 2008

Os pongo la relación de barcos amigos que navegan al lado de Sandra (Sandry):
skyfish (se acreca a toda vela)
mmarem (volando, bueno navegando tras de Rosa)
ARUAL (se despistó un poco durante la noche pero ya cambió el rumbo y lleva 4h parada)
mariahevia (embarrancada en la Bretaña)
sandormarai (tampoco me sale en la pantalla)
sandry (ya cambió el rumbo y va directa hacia Arual)
mariaad (la Rosa que se dirige la primera, sin piedad a por ella)
teo (leer el comentario anterior)
Goncogar( recuperado de un naufragio)
mariuky ( a esto se le llama empezar bien)

10 06 2008

lau tranki q ya cambie el rumbo dl barco pa no xocar


10 06 2008

Sandraa 🙂
Vaya campeona que estás echa no ?
Te deseo mucha suerte & a flote.
Un besazo a todos

10 06 2008

Crsty si tienes barco dinos como dse llama para buscarlo.
Felicidades por el premio, lee lo que te pusimos enel blog (en tu entrada)

10 06 2008

Tras unos pequeños incidentes, debidos a que aun soy patron novel. Y como buen ciudadano, navegaba con la L reglamentaria que el codigo de navegación maritima indica. Pero todo eso no fue suficiente. Y debido a un pekeño lapsus con el ancla. El Goncogar, naufragó en las proximidades de Lizzard Nord.
Pero eso es agua pasada (y nunca mejor dicho). Porque el Goncogar boat parte de tierras alemanas con rumbo 122 y viento en popa a toda vela.


10 06 2008

Grumetes….. grumetes???? ¡JA!

Superskippers!! chavalín

10 06 2008

a ver, para afloteah …
mi barco es sandormarai, que si que sale, que va ligeramente escorado a estribor para aprovechar los vientos escoceses …. jejejeje (vaya inventiva tengo)
y empiezo a incorporar a los nuevos navegantes, lastima que el programa solo permite poner a 9, creo yo …
saludos y buen viento, y que si veis bandera negra, acalaverada y con dos tibias, soy yo, y ya tengo el parche reglamentario en un ojo …
y vigilar los abordajes.

10 06 2008

Vaya regatón de amigos!! Como para no unirse!! Como soy “un pirata malo”, voy de polizón en el Skyfish, (que por acercarse a la popa de la “listilla” que zarpó primero, ve como “Sandor el Húngaro” le va a pasar por estribor, y la “Mater Marem” lo va a desventar) así que cuando se duerma el capitán, igual echo el ancla para tomar un traguito de ron, y reunirnos toda la flota. Estais invitados.
Sandra, la maniobra de presalida es digna de un “match race” ji ji ¡¡, pero guarda el remo unos dias en el camarote, que con el trajín del velamen y demás, entrenamiento no te va a faltar. ¡¡¡¡Llena tus velas y A NAVEGAAAAAARR!!!!!!
Besos para tí, y para todos los miembros de esta tripulación.

10 06 2008

Otro barco se une a la regata o treblho azul.
SANDRA ya pasó el primer control.
Todos contigoooooooooooooooooooooooooooo

11 06 2008

El mariaad claudicó ante la propuesta del pirata malo y aunque desayunar con un trago de ron debe ser poco recomendable, no pude resistir la tentación.
De todas formas, a “la listilla” algo le dice, que no debe fiarse de PataPalo, ni del húngaro del parche en el ojo, ni mucho menos… de la “Mater Marem” que las mosquitas muertas… siempre son de lo peor!!
Echo el ancla! pero no os confiéis que no voy a estar así…. una eternidad!!


11 06 2008

Querida Sandra: Soy Olga otra más de las profes, ya sigo la regata virtual ¡que guay!, estoy con Juan Andrés en la Habitación creo que os conoceis, le estoy animando para que te escriba algo y puedas explicarle como participar en la regata. Te seguiremos escribiendo. Un fuertísimo abrazo. Olga

11 06 2008

yo echo el ancla, palabra de pirata ….

11 06 2008

Hip… eessdde rooonn hesshtá vvueddiiissiimo, jo tannnmmien esssho lankla..

11 06 2008

Aprovechar ahora todos los barcos un poco rezagados y echar a volar que a esos borrachos los adelantamos en un segundín!!!!!!!!!!!!! Y los del ron, como no invitéis a mmarem a un trago no para y se nos escapa, ya lo veréis!

Un besito Sandra!

11 06 2008

El barquito nuevo (O Trebelho Azul) podía haberse buscao un nombrecito más fácil lechuga! De Galicia tenía que venir… Los vientos en las rías son más favorables que en el mar… jeje 😉

11 06 2008

La pirata mmarem no puede dejar pasar la invitación a un trago de ron, voy a echar el ancla (antes ojearé al resto de piratas enemigos, no me fio ni en pelo……). Esperamos todos con el barco de Pata Palo y así la listilla tiene que dar la vuelta.
Esperando al resto de participantes en: Lat 47º 32´7´N Lon 14º 28´36´W.
Bueno el barco de Joaquín va que se las pela.
Besiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiinos a todos los navegantes sois LO MEJOR

11 06 2008
Juan A.

Soy Juan el que conoce a Jose Carlos compañero tuyo de piragüismo, del 3ºcentro. Te agreguè al msn, pienso que para hablar mejor por ahì no?? aceptame, y hablamos!!! 😉

1 besu

11 06 2008

La que parece que está afectada por el ron, es mariahevia, que no cambia la vela y contra el viento…. (no sé yo)
Los gallegos ya se sabe… dentro de nada no sabremos si viene o va jejejj (con todo el cariño)
mmarem muy aguda hizo una maniobra para colocarse bien.. pero solo con el olor ya está fuera de combate…
todos durmiendo la siesta…..aissss que tentación…

11 06 2008

un aviso pa LAU Sandry y pa O Trebelho Azul:
n podreis conmigoooooo
por cierto s apunto otro barco + ya l mande q dejara aqui 1 firmilla cn l nombre y ahora mismo otra amiga mia esta n proceso d hacerse otro cuando l tenga ya l digo q firme n l blog.
mmareem y compañia guardarme 1 poco d ron q enseguida llegooo =)

11 06 2008


oye rosa cuidadin con mi hermana (mariahevia) q vale esta un pelin afectada x el ron pero yo q tu no tentaba q esta es capaz d doparse y nos gana a todos jajaja

na esq no se aclara muy bn con el tema

nueva tripulante toyada@arqa.com buscarla con est nombre parece raro pero es asi ok?

bueno xaoooooo bsssss


11 06 2008

Pues yo también me uno al viaje!
En el juego me llamo iYi y todavia estoy piyandole el trukillo, pero me parece que va a ser muy divertido!

11 06 2008

Muy buenas a todos….los adelantados. A los rezagados tambien. Este es un comentario dedicado para estos últimos.

Debido a mi falta de experiencia en al navegación me he visto obligado a enviar una zodiac de refuerzo, cargada con la mejor y más alta tecnología, asi como con personal especializado en el tema del espionaje para detectar las tecnicas seguidas por los navíos que se encuentran en cabeza.
Pues bien, ya tengo esa información en mis manos, y os aseguro que os dejará a todos boquiabiertos. En las imagenes, se puede observar con total claridad a personajes como PataPalo, mmarem, la listina y sandor el húngaro. Y por lo que parece…..EL RON EMPIEZA A CAUSAR ESTRAGOS.
Pinchad en el link, para ver la informacion confidencial.

11 06 2008

No pude aguantarme y dirigo mi barco directamente hacia maraad, es que está a tiro.
Tendré q volver a echar el ancla.

11 06 2008

Os habla el patrón del barco David10, hemos zarpado hoy a las 15:26 horas, y ya tenemos rumbo fijo hacia tierras Americanas, llevamos un ritmo fijo de 9,3 nudos con el viento atizandonos desde barlovento.

Desde el camarote de mi barco quiero mandar un beso y un abrazo a Sandra para que se mejore lo antes posible, en el río seguro que puedes con nosotros, pero… ¿y en mar abierto?

Un beso y mucha suerte para todos, y….


Fdo: David

11 06 2008

Y yo, que soy de puerto de mar estoy en “dique seco”, pero ¡ojo¡ me estais picando cualquier dia doy un escándalo y tomo rumbo sin parar. Sandra tengo ganas de conocerte ,pues se por mis compañeros que eres fuerte, ánimo sigue remando verás que pronto llegas a tierra firme .Besos Carmen.

11 06 2008

Bueno… bueno… ¡cuánta animación!
Bienvenidos los nuevos navegantes, toyada, iYi, y David, da gusto ver tanta vela, en la misma dirección. Seguro que entre todos, hacéis entrar la brisa en la quinta planta.
Sandra espabila… que vienen fuerte por detrás 🙂
Aviso que está a punto de intervenir el comité de competición: la difusión de imágenes privadas podría costarle una penalización a Goncogar, la colisión intencionada contra un barco que fondea inocente ¡Ni te cuento… marimar!
Y la de puerto de mar….. a ver, que eso blanco que ves, son velas… VELAS, no remos. Que no te tomaste la biodramina ¡si lo sabré yo! 😉

12 06 2008

Mar, he recibido el mensaje por medio de esta supermensajera que tengo aqui trabajando conmigo!! jeje!
La idea de las carreras de barcos, me parece genial… así que en breves me veréis navegar!! (aunque sólo sé nadar al estilo perro, así que espero no naufragar…) =D
Avisaré a Maricuqui y a Angelilla, para que también se apunten!
Besos a tod@s, y en especial a Sandra, que no la conozco, pero fijo que es requetemaja!! y será por repartir besos!! XD

12 06 2008

Por cierto… más besos desde la Escuela Infantil de la Uni Ovetense 😉

12 06 2008

Booy a tener ge hasser la ruta venesolana para drepostar unos barrilitos de gon, podque no boy a dad a vassto !hic¡ Madiahevia, en dus vodegas no tendras alguno anque sea mediobasio? Poddffaaaaa ! ke adguien taiga cafeeeeeee¡

12 06 2008

Menos mal que Goncogar es discreto y no ha puesto los nombres de los personajes del vídeo (mirarlo prfaaaaaaaaaaaa). Yo me siento muy identificada. Ni se te ocurra decir quién somos cada uno.
Y sin que nos escuche nadie tengo información confidencial, esta mañana hemos visto a Sandra y ¡NO PIENSA PARAR EN EL PUNTO DE ENCUENTRO! Ni por todo el ron del mundo.
Todos atentos y al abordaje.

12 06 2008

Otro barco está en la regata, no nos decía nada pero …. todo se sabe en esta regata, se llama “raulcue” y con esto de los exámenes dejó el barco a la deriva y …. no se que pasa que a todos les gusta la costa de La Bretaña Francesa.

12 06 2008

\_/D \_/D \_/D \_/D \_/D \_/D
¿Serán suficientes cafés?
Que guerra dáis 😉

12 06 2008

sandormarai vas directo a chocar cn migoooo

12 06 2008

El ron…. mariuky, el ron…
Ya te pasó por los pelos… ahora va a por Goncogar 😉

12 06 2008

tranki mar q si q paro era pa asustart jajajaj si ahy ron t aseguro q si paro

y un poco d poteeeeee jajajaç

xao bssssssss


12 06 2008

Yo diría que el ron hace más estragos por detrás que por delante
iYi, rectificar es de sabios!! y… mariahevia …mmmmm ¿irá a por un irlandés?
marinaaaaaaaaaaaaaaa, prenda, acércate a mí, bien juntinas, que se acercan y son muchos!
¡ Van a darnos como p’al zorro!!
Sandri, cariño (mar dixit) pa pote estamos… con el mareo que llevamos y lo que nos espera. ¿vosotros vistéis el remolino de flechas que tenemos por delante? aisssss

12 06 2008

Voy pa ya no dejo soooolaaaaa a rooooosiiinaaaa derechaaaaaaaaaaaaaaa com una veeeeela. Hip!!

a toda vela cmpañerosSs, Boston está…más o menos ahí xD

12 06 2008

a la espera de los rezagados. Ya teeeeg losss primerrrros trrragos de ron en el corpo. ezquiiisssito

12 06 2008

¡Cagondiez!, yo no tengo barcu, pero vaya mareo (por el ron), esto ye la mondaaaaaaaaaaaaaa. Tais todos chiflaos. Besos.

12 06 2008

Pues yo dejo el barco con una sola vela a la deriva, espero no pasarme del punto de encuentro :S solo viajo a 2,4 nudos… Se ve que hay mucha competencia, y barcos muy rápidos va a estar muy interesante jejejeje

P.D. Traigo la bodega llena de ron añejo, así que… QUE NO PARE LA FIESTA!!!!

12 06 2008

“La flota del nalón” Ranking en The Artemis Transat
ARUAL ——–2524
Sandry ——–2531
O Treblho azul–2532
David10 ——2535
Raulcue———2661(ligeramente encallado)
Teo 3096 —–(naufragado, me temo)

13 06 2008

Gggoonkojjaaaar, valla maarshaaa, sse notaaan bien las sknackwuuurst, i que solo le zaas a la sserveessa (eessa tripita).
Sandry, bas como un aamoto, ¿no esdaras tirando de paalaas, veedaaz?

13 06 2008

ey lau frena q ya t as pasao l punto d encuentro y t vas a quedar sin ronn
l mismo pa goncogar

13 06 2008

Bueno me acabo de registrar. Me lla mo crisfm y venga muxoss animosss Sandraaa.
Ya veras como te mejoras pronto.!!!

13 06 2008

El punto de reunión “A Flote tabern”, mantendrá la barra libre, durante todo el viernes. Podeís bailar y moveros libremente tomando posiciones. Esperando que David llegue ( Toyada,iYi, mariahevia, hay que apresurarse, crisfm, ni te cuento)
Mañana sábado, a las 13 horas cerrará sus puertas. A partir de ese momento ,levar anclas y…… ¡¡EL ÚLTIMO PAGA!
Buenos vientos 🙂

13 06 2008

Ya estoy unida al punto de encuentro!!!!!!!!!! pero hasta que el goncogar frene no se yo si pararme del todo, q no se si fiarme… pero mientras, un traguito de ron no me venía mal… jeje. Oye, una pregunta, dónde está el punto de encuentro ese del que hablan, el “A flote tabern”?

Un besito a Sandra, porque ron no te puedo dar q estás un poco lejos, jeje.

13 06 2008

Poodd donde veaazz lasss boollaaas que ponen Captain Morgan, Havana, Brugal, Caribe, Negrita, perdo toodazzzz ze apeyidam rruumm.
Las coddientes madrinas no las yevannn máasallá de Lon: 15º 25′ W aproxssss.

13 06 2008

Juas, juassssssssssssssssssss. Empieza el fin de semana, (aunque por estas latitudes empieza el miercoles) y que mejor forma de empezar que brindar con un pokito de Ron. Ya he echado el ancla y me dispongo a relajarme un poco. pero no os confieis……………que mañana pienso dar mucha guerra.

13 06 2008

Creo que voy a tener que encender el motor de emergencia para llegar al punto de encuentro… porque mi barco no quiere avanzar jejeje voy con la vela mas grande, viento a favor… y nada a 4 nudos que voy… en vez de una regata mi barco parece que va de crucero, creo que los excesos de ron ha afectado a mis tripulantes, y no pueden ni arriar las velas… habrá que cerrar el grifo de la bodega jejeje

Mucha suerte pa todos, y que gane el mejor!!!

13 06 2008

Daviddd, jo ssoy un polizszszon, pro porrr lo que le cojo al kkpitan (lo odio), dessde donde estaaasss, prrrueba rumbo 250, beela cod:O, o innnnkklusif la florencia gif. agurrrrr ben.hurrrrr

14 06 2008

Eeell rrhoon me vaa maataaá, sshi no lo assseis loss nabegantes..
Un eggooorr de cárrculo (baassya como vevenn esshhtaas dripulazioness): lass votellaass de rroon ke vaalizan “A Frote Davern”, yegan a essta ora -3.00 a.m.- asssta L:15º45’30” (essso si, vaastante apiñadritas). oossea que kuando sieerre ehr shiringo, yse del cannñonaso de shalida, mi shesstante me dizzee, keel gruesso de la frota, caerá coomooo pooorr……pooorr…..uuufffff…… + 1º30′ ( o assin)

14 06 2008

Pero bueno no quedabamos en arrancar a las 13:00h; quedé al mando del barco de Mariuky y me mata. Sin piedad a pr vosotros. iYi si no te hubieras pasado la puerta…. Acelera q tu puedes.

A todos los regatistas ¡¡¡¡¡¡¡¡ Hay un evento muy importante la próxima semana!!!!!! Todos atentos será sobre la mitad. No puedo adelantaros nada todavía la jefa de la regata (la listilla) lo está organizando todo.
SANDRA estás durmiendo???????????? Bien q disimulas tu barco va que no veas arrrrrrrrrggg

14 06 2008

Socoooooorrrroooooo, hoooombreeeeeee aaaalllll aaaaaaagguuuaaaaaaaaa¡¡¡¡¡¡¡¡¡
Brrrrrrfffff kee friiiia’stáaa, esstoo sii que te kitalakurda desopetón .
Er kapitán ma pillaaao y mea tirao pod la boodda ¡¡¡¡
k’ alguien mayuudeee podddffaa (ya sabeis las votellitas de ron del bacío kaparte del valizamiento, agora me sirben de flootadors)
El chiringito adelanta el cierre (¡¡est si kes raro!!) por humedades varias.
La Sandry y el Hungaro van como motos, y la listilla no les va a la zaga, y el cabr….azo que me tiró al agua….., Arual, Goncogar, Mariuky.. toda la flota..
A FLOTEEEEEEEE y A Navegaaaaaaaarrrrrrr
Buena travesia para tod@s.
(Sandry….Sandry…. Suéltame ese remitooo o al Comité vas..)

14 06 2008


oyes vais a seguir parados o ya arrancasteis xq si no arranco yo tambien

q esto se esta poniendo interesante jjaa

venga xao bsss


14 06 2008

ha ber, voteya sovre laz cuveirte der galoete i …
quien decia que las 13 horas se llevaban las anclas ?
eso ES una trampaaaaaaaaaaaaaaaaaaaaaa !!!
pero no veis com va Sandrita ? Y yo que me quedaba para hacerle compañia, y ahora … ahora … mecachisssssssssssss
Sin compasión, a toda vela …. Pero NO VALE QUITARSE LA CAMISA Y ATARLA AL PALO MAYOR para conseguir mas vientoooooooooooooooo ….
aggggggggg …. ni soplar en las velas, ni remar, ni .. ni …
Y las botellas de ron, por la bordaaaaaaaaaaaaaaaaa …
aisss, y siento decir que no me caben los nombres de todos los nuevos componentes, pero enhorabuenaaaaaaaaaaaa …
y … glu, glu, gluuu, eruztimotragu di ronnn, hip, i voteya ar auga …

14 06 2008

esto s tongoooo
teniamos q empezar todos n fila n 1 + alante y otros + atras
mar gracias por ponerme n marcha l barco 😉
t debo 1

14 06 2008

¡Mayday, mayday. maydayyyyyyyyy!
La tectonología desde la alta montaña, no es ALTA tecnología. Sin acceso a la pantalla de la regata, Buahhhhhhhhhhh.
Navegando a ciegas, no me hago responsable de lo que el mariaad, pueda hacer. Avisados estáis!

14 06 2008

Si es que… no se os puede dejar solos. Enlace, imprescindible y urgente, para Patapalo y Joaquín. Sandrita y Goncogar tampoco se libran… Pinchad el enlace
stilus Corrector ortográfico on line.
Además en A pié de aula, tenéis un magnífico tutorial, A partir de ahora, no vale de disculpa…. ni el ron 😉

14 06 2008

SSSOOOSSS NAAUUFRAGO. MEENSHAGE PADA MARIAHEVIA, mi uuunica esperansa eres tu. Ssholoo mee kedan 2 voteyitas de roon ( o menos), si me recogess enn Lat: 47º 00′ Lon:15º 00′ massomenoss, a alguno le podddremos coger el cuul.., peddónnn.., loo abooddamos polapopa.
Desde donde estasss miraaa tu rumboo, si no es el 255 mu cerkitaandará.
La vela prueeva coodigo ‘0’ o genova (seguro quessta mejorrr).
Aaal reeesto la frooota…, bueenoo mushoo coompadreo y ronsitos los viernees, peeeroo coon la ressaka, el PaataPaalo.. jaarto de pulpo crudo y aguademar.
Coomo shoy un pirata-malo, maaa noon troopppo, ke noh nausssfragueisss.

15 06 2008

Saludos marineros!
David10, casi mejor que cambies tu rumbo hacia abajo, que hay que pasar el siguiente punto de control por abajo que sino te vas a dar de frente conra los icebergs!!!!!! Y no queremos naúfragos en esta carrera, q sino hay q ir a por ti!!!!!! jiji. Yo de velas no se mucho, pero sigo a sandormarai y a skyfish, q parece q algo de ide tienen…(van como motos leche!)

Saludos desde mar abierto!

15 06 2008

Jejejeje gracias Laura 😛 yo es que me voy fijando por las flechitas que hay en el agua, que creo que son la dirección del viento… entonces veo que por arriba es mas favorable, todas son pa la izquierda (hacia Boston), y la puerta, no se si hay que pasarla por abajo, o por arriba, o da igual :S no se pero yo me fije en algunos que han tenido que dar la vuelta a la segunda puerta (porque se la saltaron) y se la cuentan igual la pasen por arriba o por abajo, espero no equivocarme y llegar a Boston 3 meses después que vosotros jejejejejeje.

Pero gracias por avisar, porque no pensé que avanzaría tanto durante la noche :S pero veo que se han puesto las pilas los marineros y ahora no hay quien los pare… me llevaban a una velocidad de 21 nudos 😀

P.D Maria al final ya te pase pero no te preocupes que tendre que dar la vuelta… Besitos pa todosssssss!!! y que gane el mejor!!!

15 06 2008

Si es que… quien me mandará a mí confiar en un pirata. ¿Que nadie me vuelva a llamar la “listilla” ¿vale? 😉
Incorporada del fin de semana, cojo el timón. No sé que pintan el Foncia, BT y Pakea Vizkaia 2009, ahí delante, pero…. allá voy!.
¡Ánimo Sandry! que tienes a mmarem a tiro, a por ella, PERO YA! 🙂

15 06 2008

“La flota del nalón” Ranking en The Artemis Transat- Domingo 22:00h
sandormarai 2455
david10 2461
skyfish 2474
mariaad 2475
mmarem 2485
mariuky 2486
Goncogar 2488
sandry 2491
Arual 2496
O trebelho azul 2524
mariahevia 2530
iYi 2574
crisfm acercándose
toyada@arqa.com, raulcue y teo ¿definitivamente naufragados?

15 06 2008

¿Avisará alguien a O Trebelho azul? ji ji ji

16 06 2008

Que diferencia el navegar sobrios…,después del finde de ron y mariachi, todo el mundo se ha puesto las pilas.., perdón, las velas.
Hay varios desafios particulares, pero la mayoria tan cercanos entre sí, que hace presagiar una 2ª parte de la regata. muy.. muy.. interesante.

Sandry, se nota que “te olvidaste” del remo (temporalmente, faltaría más) y ya te veo desventando y “comiéndole la popa” a más de un@.
¡¡¡¡¡¡¡ANIMO CAMPEONA!!!!!!!! ¡¡¡¡¡¡¡¡ TU SI QUE PUEDES!!!!!!!!!! Un abrazote.

Aaaalll aboordaajeeee!!!!! Aaaa navegaaaarr!!! Aaaaa floootteeeeeeeee!!!!!!!!!!!

Saludos y mucho viento en las velas al resto de la flota
Nos vemos en Boston.

Kon qhe vevida pitica de ayí bodremos zenlevrarlo?
¡¡¡Khe noo seeeaa gghhoonnn, poodfaboodd!!!!

16 06 2008

Por cierto…el que acaba de remitir el mensaje soy yo… PataPalo, pero no el grumete borrachin que tiré por la borda (con menos peso navego mejor), ese es un pirata-malo, yo soy bueno;
Estooo……bueno; bueenooo-bueeenoooooo….tampoco;
A ver que me lio….,

Yo soy Pata-Palo (con mi patita de palo y todo, no vayais a pensar que es cochina envidia ), un “pirata-no-tan-malo”, y se nos distingue a primera vista (amén de por el gracejo al andar), porque a diferencia de mi alter ego, que lo hace por estribor, yo cojeo por la amura de babor, y como YO SOY
el skipper del barco, uso bastón (faltaría más..,l’escalafón c’est l’escalafón) je! je!je!

Bueeeeno, pooss’eso….

16 06 2008

Patapalo……entrolleste igual en la realidad que por internet. MENOS TEORIZAR Y MÁS PRACTICAR.

16 06 2008

¿Más practicar ?… ¿MÁSSSSSS ? pero si vive en alta mar!!
Ánimo Sandry que tu hermana te va a pillar!!

16 06 2008

esto es una super cagadaaa
l barquito n se m da la vuelta sin paraaaar

me estoy poniendo negraa

17 06 2008

hola soy jose de 3º centro acabo de entrar al blog y tengo una pena tremenda de no haber podido navegar contigo.
Te seguire en la regata , espero k todo te salga muy bien.

17 06 2008

Que alguien me confirme, ( porque lo leí en algún foro) que la Puera de Hielo, puede pasarse, de Norte a Sur, de Sur a Norte, o sencillamente dejando las dos boyas a babor, sin tener que atravesarlas,pasando por el Norte. Patapalo, ¡trabaja algo!

17 06 2008

apuntarme que os voy siguiendo

17 06 2008

La puerta de hielo se puede pasar de norte a sur, de sur a norte, de este a oeste….. como quieras….pero hay que pasarla, por la banda de estribor, o sea atravesar la puerta dejándola a tu derecha (mirando a la proa -delantera- de tu barco)

17 06 2008

Mmmmmm. me lo pensaré.

17 06 2008

En la web de liveskipper, hay un articulo sobre la puerta de hielo

17 06 2008

Soy faTy,,rosa me dio clase y na k me dijo k me pasase y firme tamien firme en el otru lao peRo va voy firmar aki tambien xD,,

tobia no pille omo se juega a eSo peRo weno jiji

áNimo a Sandra!! xD
k denTro poko ia taS remando!! (:
el tiempo pasa rapido xD

beSukSsSsS ^^

17 06 2008

Vamos a decir que te dí clase…. de matemáticas. Lengua…. no sé quién te la daría…
Aissssssss ¡vaís a matarme! 😉
Un beso Faty

17 06 2008

Mensaje para Jose.
Jose_trevias, inició la regata con buen viento. Como teníamos previsto, le viaje de Oviedo a Trevías sin tocar el timón, te hizo pasarte una puerta. De todas formas, SIGUE ADELANTE. Aunque no te validen la llegada a Boston, intenta seguirnos, que esta regata será un entrenamiento y en el mes de Julio, seguro que participas en otra, con título de SUPERSKYPPER.
Ánimo, que tú puedes. 🙂

17 06 2008

a ver, a ver …. leo por ahi que hay veleros que dan la vuelta inopinadamente, sin que se haga nada especial al respecto.
Por lo que tengo entendido, hay un botón que es el responsable de esto.
hay cinco de amarillos, pequeños, y empezando por la izquierda son
ancla, (y las velas) foresai, genoa jib, code 0 y spinnaker.
Luego hay un botoncillo, abajo, en el que hay dibujado un timón pequeño.
ES SOLO PARA PIRATAS DE PRIMER ORDEN, … BOCANEGRA, EL CORSARIO ROJO, JACK SPARROW, CAPITAN GARFIO, etc … Si no eres uno de esos, no lo uses, te llevará al mar de los naufragios.
En realidad ese botón fija el timón a un angulo determinado, y si cambia el viento, cambia asimismo el rumbo. O sea, para avezados navegantes.
Sandra podria usar los remos para enderezar su velero, pero no lo aconsejo …
suerte a todos, que os veo lejos yaaaaa ….

17 06 2008

me ahogooooo!!!!!!!

17 06 2008

Porfaaaa explicar para los novatos como tenemos que pasar esa puerta yo no se si hay q pasarla o no, si dejo lo q sea a estribor ( es la derecha no?)…..
Contarnos algo

17 06 2008

A ver, Mar. Lo primero acercarse a un distancia conveniente, luego estirar la mano, coger el pomo y girarlo, empujarla lo justo, y… ¡avanti tuto!
Yo de momento, hago un curso acelerado de pirateria de primer orden, y planeo alguna maldad para cortar las velas a Joaquin el Húngaro.
Que tiemble, ¡qué se habrá creído!! Tú de momento, vigila el logo de aflote conmigo. 😉

18 06 2008

Hola Sandra! Soy María, tu tutora del insti (me pondré lo de Mary porque ya veo que tengo una tocaya por ahí…). Ya sé que llego un pelín tarde en presentarme pero bueno, nunca es tarde si la dicha es buena… y es tan buena como que mañana se inauguran las vacacionessssss y que vas a tener unas cuantas cosillas que celebrar (y no me refiero sólo al cumple, jeje). Pero no me adelanto… recibirás próximas noticias from Ventanielles.
Voy a ponerme a investigar en el blog, porque estoy intrigadísima con el rollu esi de los barcos, tovía no sé de qué va esto, pero si se trata de un juego temblad cuando lo adivine, todavía vais a tener una dura competidora, ya veréis… Un besazo de parte de tus compis y profes!!!

19 06 2008

“La flota del nalón” Ranking en The Artemis Transat- Jueves 19:00h
Parece que salimos de la encalmada.
sandormarai 2384
skyfish 2388 ( jiji no lo pillas eh?)
mariaad 2399
mmarem 2402
Goncogar 2407
sandry 2408 ( tienes al alemán a tiro. ÁNIMO)
david10 2409
Arual 2420
mariuky 2430
O trebelho azul 2438
mariahevia 2439
iYi 2485 (ánimo)
crisfm 2493 (remontando)
toyada@arqa.com 2594 ( increíble!)
jose_trevias 3223 (con piloto automático y mucho mérito)
raulcue y teo ( siguen en La Bretaña)

20 06 2008

OOOOOOLÉÉÉÉÉÉÉÉ, Saaanndryyy, Saaanndryyy, Saaanndryyy, Saaandryyy….

Menudo regatón… como se nota que eres deportista y una luchadora nata.

Al alemán te lo desayunas…., a una profe te la almuerzas, a la otra le quedan 2 telediarios……y Sandor El Húngaro y el pirata-no-tan-malo ( tendrá morro…) que miren de vez en cuando a popa, porque pueden llevarse una sorpresa…y se les “fundan los hielos”. (dejad algo para los chupitos de ron)

Sandry, cómetelos a toos siempre a flote y a naaaavegaaaaaaaarrrr.

Saludos y buenos vientos al resto de la flota.

20 06 2008
Ah Oviedo

chachánnnnnnnnnn! presiento un fin de semana muy entretenido, El húngaro perdió la posición y Sandry viene “volando”
¿Qué nos encontraremos el domingo cuando volvamos? aisssss
Buenos vientos

20 06 2008

Jejeje vaya pasada que nos estáis pegando!!! venís todos como balas!!! Sandry nos va a pegar una pasada… (a mi ya me la pegó…) pero seguiremos luchando, hasta Boston no esta todo dicho!!!

P.D Mañana seré un poco mas viejo, por lo tanto tendré mas experiencia… temblad!!!

Salu2 y suerte para todos!!!

20 06 2008


La puerta de hielo NO ES NECESARIO ATRAVESARLA, sino simplemente pasar cualquiera de sus puntos por la banda de estribor (la derecha);

En el momento que alcanceis la “entrada” de la puerta ( L 47º 00′ 00”) os será validada.

21 06 2008


Algunos ya lo habreis detectado… para el resto.. no os extrañeis si vuestros barcos parece que no avanzan,,,¡¡¡¡¡¡¡ ES QUE NO PUEDEN AVANZAR ¡¡¡¡¡

En un principio pensé que era un boicot de El Húngaro y el “otro” Pata-Palo, para descansar el fin de semana sin miedo a que ni Sandry ni Mariaah les dieran caza.., pero no.., desde las 13 h. aprox. está bloqueada, no sólo esta sino otras regatas; Los que también están de finde son los administradores de la página, y parece que hasta el lunes no se podrá navegar….. ¡¡¡¡QUE FAENA¡¡¡¡¡

En fin… habrá que echarse unos traguitos de ron..y descansar un poquito para la segunda fase de la regata, que va a ser más dura y emocionante que la primera.

Sandry, prepara tu estrategia y cómetelos a tooodoooss¡¡¡¡¡¡¡

21 06 2008

Por cierto…. David, mañana TODOS seremos más viejos no? je¡ je¡

Deduzco que será tu cumple…, si es así….

22 06 2008

jejejeje pues si… ayer fue mi cumple… me siento muchísimo mas viejo… la artrosis empieza a hacer mella y la cabeza se me va, -creo que esto ultimo es por el ron, no lo se- cumplí ya muuuuchos años (menos de 22 y mas de 20…) pero bueno… intentaremos llevarlos lo mejor posible 😉

Que los vientos sean propicios para vos y para el resto de navegantes!!!


22 06 2008

Felicidades David¡¡¡¡¡¡¡
Siento lo de la artrosis. 😉
Será posible que ya sea por el ron o por la artrosis tengamos alguna posibilidad los demas?
Sandry tu crees que Rosamaliiiiiisima tendrá algo de esto?
A navegar

22 06 2008

¡Muchas felicidades David!!!, aunque un poco tarde, lo celebraremos. Entre los tuyos y los de Sandra…
Necesitaremos Bomberos!

23 06 2008

¡SANDRYYYYYYY! condenada!!!! atiborrándote de tarta y sin modificar el rumbo.
Tírate al sur que tienes de dejar una boya al menos a estribor!!!
( a que pilla un empacho de chocolate y se nos pone mala…… ) 😉

23 06 2008

Sandra ya tiene artrosis acaba de cumplir 17. Je Je
Creo que hoy tiene empacho de tarta

24 06 2008

Así que poniéndote morada de tarta porque es tu cumple…. Con la renontada tan genial que llevas, ya me extrñaba…. me parecia que hoy lunes te habias despistado un pelín para pasar la puerta de hielo, y pensé….mecachisss….. otro finde.. con menos hielo que ron, pero no……….

Pues..¡ MUCHAS FELICIDADES¡¡ #y que cuumplaas muuchoss maaaaasssss..#

Mar tienes razóm…no me extraña lo de la artrosis… a partir de los 16, es una edad tan dura…verdad? (que endivia…je¡ je¡)


24 06 2008

cumpleaños feeeliz
cumpleeeañooossss feeellliiiizzzz
t dessssseoooo sssandryyy
feeeeeeeeeeeeeeeeliiiiiiiiiiiiiizzzzzzzzzzz!! 🙂

24 06 2008

Sandry, te veo remontar pasándo las olas de dos en dos, Mis intenciones son claras, voy a saco a pillar al Húngaro!! 😉

25 06 2008

Sandra, es una alegria verte virar para coger bien la puerta esa de marras.
No te creas a Rosa, entiende poco de magyarismos, asi que NO me pillará.
Sé que el lunes fue tu cumple, he visto las tartas y he visto las velas. Tambien sé que eres amiga de los dulces. Sé que aprecias las ideas de futuro.
Para ti va esa pequeña poesia de Tagore.
Para ti va esa concluyente poesia de Tagore ….

-MAR, ¿que estas hablando?
– Una pregunta eterna.
– Tú, cielo, ¿que respondes?
– El eterno silencio.

que sean unos felices 17 … y a por la mayoria de edad en un añito de nada ….

25 06 2008

Lo que verdaderamente se me da bien, es la maniobra de cambiar el avatar.
Espero que os guste. jijiji

25 06 2008

Creo que alguien se ha comido a un húngaro….

26 06 2008

bueno yop m despido por una temporadita pq m voy a america y n se si podre entrar n la pagina desde alli y l + fundamental n se si mi familia tendra ordenador espero q sip pq si nop mueroo
muchos besoos
y animo sandry!!!!

26 06 2008

Anda… anda…. no te morirás tanto. Y no te despidas, que para las Américas vamos todos!!, Algunos llegaremos a Florida 😉
Buenas vacaciones Maria.

4 07 2008

“La flota del nalón” Ranking en The Artemis Transat- viernes 4- 19:00h
Parece que desde las vacaciones algunos barcos van un poco a la deriva, otros sin embargo están ya en Boston esperando.
1º- skyfish (por lo menos estaba el primero ahora…. no lo encontramos)
2º-sandormarai 2150 finalizado
3ª mmarem 2154 finalizada
4º Goncogar 2159 finalizado
5ª mariaad 2161 finalizada
6ª Arual 2165 finalizada
7º-david10 2170 finalizado
8º- mariuky 2175 finalizada
9º- mariahevia 2211 finalizada
10- sandry 2295( será por kilometros)
11-O trebelho azul 2298 ( no quiere llegar a Boston atracó más al sur)
12- iYi 2340
13- crisfm 2437
14- toyada@arqa.com 2445
jose_trevias , raulcue y teo (perdidos en el oceano)

15 10 2009
Jornadas de Coordinación de Defensores del Pueblo « A flote

[…] Se trata de reflexionar sobre las Tecnologías de la Información y la Comunicación como instrumentos para compensar desigualdades y superar barreras de comunicación, y va a representarnos Sandra Hevia contando  una experiencia que todos recordamos como muy especial. La Regata virtual en la que participamos en junio de 2008  coincidiendo con el final de un curso muy duro y su periodo de aislamiento durante el transplante.  Os recuerdo el enlace  de la entrada que llamamos Descenso del Nalón. […]


Introduce tus datos o haz clic en un icono para iniciar sesión:

Logo de WordPress.com

Estás comentando usando tu cuenta de WordPress.com. Cerrar sesión /  Cambiar )

Google+ photo

Estás comentando usando tu cuenta de Google+. Cerrar sesión /  Cambiar )

Imagen de Twitter

Estás comentando usando tu cuenta de Twitter. Cerrar sesión /  Cambiar )

Foto de Facebook

Estás comentando usando tu cuenta de Facebook. Cerrar sesión /  Cambiar )


Conectando a %s

A %d blogueros les gusta esto: